Introduction
Tomato chlorosis
virus (ToCV) is a
newly-emerged virus that is transmitted by the whitefly. Once ToCV infects
plant hosts, it causes a yellowing of plant leaves, resulting in the delay of
fruit maturation, reduced total yields, and finally, causes serious economic
losses to farmer households (Wintermantel and Wisler 2006). The disease was first discovered in tomato
plantations of Florida in 1989, identified as ToCV in 1998, and then spread
rapidly throughout the world (Wisler et al. 1998a; Navas-Castillo
et al. 2011; Tzanetakis
et al. 2013). With the exception of
Antarctica and Oceania, ToCV
has been found in more than 20 countries on the other five continents (Wei et al. 2018). In China, ToCV was detected
in Taiwan for the first time in 2004 (Tsai et
al. 2004), and was thereafter detected in tomato and pepper in greenhouse
in Daxing province, near Beijing (Zhao et al. 2013). At present, the virus has
been found in additional tomato-growing regions in different provinces,
including Beijing, Shandong, Henan, Tianjin, Shanxi, Jiangsu, Liaoning, and
Guangdong, among others, and has caused considerable economic damage (Zhao et al. 2014a; Gao
et al. 2015; Hu et al. 2015; Zheng et al. 2016; Tang et al.
2017; Wang et al. 2017).
ToCV belongs to the genus Crinivirus in the family Closteroviridae, and the genome
is composed of two single-stranded positive-sense RNA molecules, RNA1 (8594–8595
nt) and RNA2 (8242–8247 nt),
which are separately encapsidated in linear virions (Wisler et al. 1998b; Liu et al. 2000; Martelli et al. 2002; Kataya
et al. 2008; Albuquerque et al. 2013). RNA1 contains four open
reading frames (ORFs) that encode proteins involved in virus replication, while
RNA2 contains nine ORFs that encode proteins mainly involved in virus encapsidation, movement and vector transmission (Karate
2000; Martelli et
al. 2002; Livieratos et al. 2004). Previous studies verified that only RNA1 and RNA2
simultaneously existed, the plant could be infected successfully by ToCV (Wisler et al.
1998b; Wintermantel et al. 2005; Wintermantel and Wisler 2006; Orílio et al. 2014). ToCV, like other viruses of the
genus Criniviruses,
is phloem-limited and not transmitted by mechanical inoculation or seeds (Wintermantel
and Wisler 2006). Under natural conditions, ToCV can only be transmitted by
whiteflies in a semi-persistent manner. B. tabaci, Trialeurodes vaporariorum
and T. abutilonea,
belonging to two genera, can spread the virus by biting and sucking the phloem
of plants. All of whiteflies have effective transmission abilities in spite of
different spreading efficiencies (Wisler et al. 1998a; Wintermantel
and Wisler 2006; Shi et al. 2018).
At present, ToCV
research is still in a primary stage, and only few studies have investigated nosogenesis, plant resistance, vector-virus-host
interactions and the selection and breeding of resistant varieties. Therefore, it is necessary to
obtain a single stable source of single infection of ToCV for further correlational
research. In this study, we established the inoculation
technology of ToCV
by using the pathogenic N. benthamiana as rootstock and healthy tomato plant as
scions, to provide technical support for ToCV research.
Materials and Methods
Insect
rearing
B. tabaci MED (formerly Q biotype) was obtained from the
Applied Insect Laboratory of Beijing Academy of Agriculture and Forestry Sciences, and raised on cotton plants at a temperature of 26 ± 1°C, with a relative
humidity of 70 ± 5%
and a photoperiod of 16: 8 h (L : D). The purity of B. tabaci MED was monitored regularly
according to the mitochondrial cytochrome oxidase I gene (mtCOI) (Chu et al.
2012).
Plant
cultivation
Tobacco seeds (N. benthamiana) were obtained from Shandong Agricultural University.
The cotton seeds (‘Jimian 616’) were provided by
Institute of Cotton, Hebei Academy of Agriculture and
Forestry Sciences. The tomato seeds (Jinpeng No.1)
were purchased from Xi’an Jinpeng seedlings Co. Ltd.
The seeds of different plants were sown respectively in a plate with 75 holes,
and incubated in a growth chamber at a temperature of 25~27°C. After five true
leaves had grown, the plants were transferred to a pot with 12 cm diameter for
the following experiments.
Inoculating
infectious clone
of ToCV
The infectious ToCV clone used in this study was
provided by Zhou Tao of China Agricultural University. Thirty μL of Agrobacterium
tumefaciens C58C1cintaining RNA1 and RNA2 clones
were added to 30 mL Luria-Bertani (LB) broth l
containing rifampicin (25 μg/mL) and
kanamycin (50 μg/mL),
and was oscillated at 28°C, 200 rpm/min for 12 h. The bacterial cells were
collected by centrifugation, and suspended for 4 h in MMA buffer (10 mM MgCl2, 10 mM
MES, 200 μM
As). Suspensions were then adjusted to a final OD600nm
of 1.0. Next, the bacterial cells containing RNA1 and RNA2 were mixed in a 1:1
ratio. Each healthy plant with five true leaves was injected with about 0.5 mL
of bacterial suspensions on the underside of leaves using a 1 mL syringe
without a needle (Zhao et al. 2016). Plants were cultivated in a growth
chamber under the same conditions described previously. After inoculation for
21 days, the infection rate was detected by reverse transcription-polymerase
chain reaction (RT-PCR), and Agrobacterium
with no plasmid pCY was used as the negative control.
Fig. 1:
Different grafting methods of tomato plants. (A) Approach grafting. (B) Cleft grafting
Effects
of different rootstock
on virus accumulation
To determine the effects of different rootstock
on accumulation of ToCV,
two treatments were set. Treatment A refers to the grafting healthy tomato onto
pathogenetic N.
Benthamiana plants used as the rootstock.
Treatment B refers to the grafting pathogenetic N. Benthamiana
onto health tomato plants used as rootstocks. Each treatment used 30 pathogenetic N. Benthamiana plants and 30 healthy tomato plants,
respectively (in triplicate). After grafting for 7, 14, 21 and 28 days, the
tomato plant leaves were collected to detect virus accumulation by qRT-PCR and analyzed the difference between treatments.
Effect
of different grafting
methods on the transmission
of ToCV
Here are two grafting methods, including
approach grafting and cleft grafting. The Approach grafting method is shown in
Fig. 1A. When the stem diameter of the N.
benthamiana plant was up to 2 mm, the upper stem
was cut off in the middle of the third and fourth true-leaf using a sterile
blade at a cut angle of about 45 degrees. Then cut off diagonally the latter
stem of the scion of tomato just keeping a heart and a leaf at the same cut
angle with rootstock, aligned the two incisions, and fixed them with grafting
clip. The cleft grafting is shown in Fig.
1B. When the stem diameter of the N. benthamiana plant was up to 2 mm, the upper stem was
cut off in the middle of the third and fourth true leaves with a sterilizing
blade, then cut vertically the latter stem with a 1.5 cm
incision from top to bottom. The scion of tomato keeping a heart and a leaf was
cut off partial stem, insert the incision of the N. benthamiana plant, and fixed them by
grafting clip.
To
determine the effect of different grafting method on the incidence of ToCV, we
performed treatments A (approach grafting) and B
(cleft grafting). Each treatment used 30 pathogenetic
N. benthamiana plants
and 30 healthy tomato plants respectively (in triplicate). The tomato plants
were grafted onto N. benthamiana
plants using different grafting methods under unified production
management. We collected the leaves of the tomato plants 21 days post-grafting
and detected the incidence and the accumulation of ToCV using PCR and qRT-PCR, respectively.
Transmission of ToCV in grafted tomato by
B. tabaci
Newly emerged adults of B. tabaci MED were used for transmission
assays. One hundred ToCV-free
female B. tabaci
populations were reared on the underside of true leaves (the third one numbered
from bottom to top) of pathogenetic tomato in
insect-proof cages. Thirty B. tabaci adults were collected after feeding for 48 h and
stored at -80°C until experiments to detect the virus acquisition
rate. Experiment had three replicates, 100 B.
tabaci per replicate, and ToCV-free female B. tabaci as a
negative control.
Five ToCV-infected female B.
tabaci were reared on the leaves of ToCV-free tomato
plants that were at the five true leaf stage and
incubated in insect proof cages for 48 h. The leaves of tomato plants were
collected to detect the incidence rate of ToCV by RT-PCR
after cultivating for 21 days in insect proof greenhouse. This experiment was
performed with three replicates and 30 tomato plants per replicate. ToCV-free
tomato plants were used as a negative control.
Total
RNA isolation and cDNA synthesis
Total RNA was extracted following the protocol
of the RNA extraction kit (Sangon Biotech, Shanghai,
China), and the quality was detected using a Nanodrop
2000 Spectrophotometer (Thermo Scientific, Waltham, USA). Two hundred ng of total RNA (OD260/OD280: 1.80–2.10) per sample was
used for subsequent cDNA synthesis. First-strand cDNA was synthesized using EasyScript
First-Strand cDNA Synthesis SuperMix
(Vazyme Biotech, Nanjing, China), according to the
manufacturer’s instructions. The synthesized cDNA was
stored at −80°C until use.
Detection
of the incidence of ToCV
using PCR
Two pairs of gene-specific primers (shown in Table
1), including T6-R/F (designed based on RdRp of RNA1)
and ToC5/ToC6 (Dovas and Katis
2002) were used for PCR. PCR reactions were carried out in a final volume of 20
μL, containing 10 μL
2× Taq Master Mix (Vazyme
Biotech, Nanjing, China), 0.5 μL of each
degenerate primer (10 μM, Sangon Biotech, Shanghai, China), 1 μL
cDNA template and 8 μL
RNase-free water. The PCR cycling conditions were as
follows: 95°C for 3 min, 35 cycles of 95°C for 30 s, 50°C for 30 s, extension
at 72°C for 50 s, and a final extension at 72°C for 4 min. PCR products
were electrophoresed on a 1.0% agarose gel and
visualized by GelRed staining. DNA fragment of the
expected length were gel-purified and cloned into the pMD18-T vector
(Takara Biotech, Dalian, China), and the constructs containing the target gene
fragment were sequenced (BGI Genomics, Shenzhen, China).
Accumulation
of ToCV by using a real-time
fluorescent quantitative PCR (RT-qPCR)
The transcripts of ToCV were measured by using an Eppendorf Mastercycler ep realplex PCR Detection System
(Eppendorf, Hamburg, Germany). Plasmids contain CP
gene of ToCV
diluted in 10 times for six gradients were used as the template to generate
standard curve with which to normalize the accumulation of ToCV. The primers of the CP gene
were designed using Primer Express 5.0 (Applied Biosystems,
Carlsbad, CA) (Table 1). The qRT-PCR reactions were
conducted in 20 μL reaction mixtures
containing 10 μL of 2 × SYBR Premix Ex Taq (Vazyme Biotech, Nanjing, China),
0.3 μL of each primer (10 μM), 1 μL
of cDNA, and 8.4 μL
of sterilized H2O. The RT-qPCR cycling
conditions were as follows: 94°C for 30 s and 40 cycles of 94°C for 5 s, 63°C
for 15 s and 72°C for 10 s. Melt curves stages included 95°C for 15 s, 60°C for
1 min, and 95°C for 15 s. Each sample included three biological and three
technological replicates to ensure reproducibility.
Data
analysis
Data from all experiments were analyzed using
SPSS 19.0 (IBM SPSS Statistics, Chicago, I.L., U.S.A.).
One-way ANOVA was used to analyse the variance of
each treatment, while the Duncan's new complex range method was used for
detecting significant differences between groups (P = 0.05).
Results
Infection
of infectious ToCV
clones in N. benthamiana
and tomato plants
After the infectious ToCV clone invading N. Benthamiana
and tomato plants for 21 days, the suspected DNA fragments of about 751 bp and 463 bp were detected both
in plants using RT-PCR (shown in Fig. 2A).
But the probability of detecting these two fragments simultaneously varied
greatly, with N. benthamiana
plants being 76.79% and tomato plants only 12.85%. After sequencing, the
results showed that the target gene sequences were more than 99.0% consistent
with the RNA1 and RNA2 sequences of ToCV in GenBank, and had high homologousness.
Table
1: Primer pairs
used in study
|
Primer
name |
Primer
sequence |
Gene |
PCR Amplicon size/bp |
|
T6-R |
RdRp |
751 |
|
|
T6-F |
CAGGGTGCCGAGAGTTTCTA |
||
|
ToC5 |
Hsp70 |
463 |
|
|
ToC6 |
|||
|
qCP-2-R |
TCTTATCTGTCATCGGGG |
CP |
123 |
|
qCP-2-F |
GGAAATTGAAGGTACACTCC |
Fig. 2:
Infection of infectious ToCV clones in N. Benthamiana and
tomato plants. (A) Detection of plants inoculated
with infectious clone of ToCV.
Note, 1, 3 N. benthamiana;
2, 4, tomato; 5, 6 negative control. (B) Symptom of the N. Benthamiana plants inoculated with infectious
clone of ToCV. (C) Symptom of the tomato plants inoculated with
infectious clone of ToCV
Fig. 3: Effects of different hosts on
the survival rate and virus acquisition capability of B. tabaci. (A) Survival
rate of B. tabaci
inoculated to the N. benthamiana
and tomato plants. (B) Detection of ToCV
in B. tabaci
feeding on the N. benthamiana
and tomato plants. Note, 1, 2, 3 N. benthamiana; 4, 5 tomato; 6 negative control
Compared
with healthy N. Benthamiana
plants in the control group, the N. Benthamiana plants in the treatment group showed
typical symptoms after inoculated with infectious cDNA
clone of ToCV
(Fig. 2B). The upper leaves
were yellow and the lower leaves showed obvious chlorotic
areas with the crispy margins. However, the tomato plants inoculated with
infectious ToCV
clone showed no symptom of disease (Fig. 2C).
Effects
of different hosts on the survival rate and virus acquisition capability of B. tabaci
Newly emerged adults of B. tabaci were inoculated to ToCV-infected N. benthamiana,
ToCV-free N. benthamiana,
ToCV-infected
tomato and ToCV-free
tomato, respectively. The B. tabaci reared on both ToCV-infected and ToCV-free N. benthamiana began
to die after feeding for 1 h, and masses of B.
tabaci had died after feeding for 2 h. The death
rate of B. tabaci
in ToCV-free
N. benthamiana even
reached 59.37%, which was significantly higher than that of the ToCV-infected N. benthamiana
and the two tomato groups. After feeding for 12 h, all B. tabaci fed on ToCV-free N. benthamiana had died, and that fed on ToCV-infected N. benthamiana had
died after feeding for 24 h. However, B. tabaci grew well on the host of tomato (shown in Fig. 3A). B. tabaci growing
on the ToCV-infected
N. benthamiana and
ToCV-infected
tomato after feeding for 6 h and 24 h separately were detected by RT-PCR, and
the results showed that B. tabaci populations were not infected by ToCV (Fig. 3B).
Table
2: Morbidity rate
of tomato plants with different grafting methods
|
Treatment |
Grafting
number/plant |
Morbidity
number/plant |
Rate
of morbidity/% |
|
A |
130 |
76 |
58.13
± 3.99b |
|
B |
128 |
101 |
79.08
± 2.48a |
Different letters indicate
significant difference (P < 0.001; N=30) by Duncan’s new multiple range
test
Fig. 4: Accumulation of ToCV in tomato plant. (A) Accumulation of ToCV of different
rootstock. (B) Accumulation of ToCV of different grafting methods. Note, standard curves of ToCV is given by y = -3.4169x + 38.97. Efficiency is 96%, R2
is 0.98. Data are mean ± SE. Different letters indicate significant difference (P < 0.05; N=4) by Duncan’s new multiple range
test
Fig. 5: Detection
of ToCV in B. tabaci and grafted tomato plants. (A) Detection of ToCV in B. tabaci. (B) Detection
of ToCV in tomato. Note, 1-5 samples; 6 negative control
Effects
of different rootstock on virus accumulation in tomato plants
After grafting 7, 10, 14 and 21 days, the leaves of tomato plants from
group A and B were collected to detect the accumulation of ToCV at different stages by RT-PCR.
The results showed that ToCV
CP gene was detected in the plants from treatment A after grafting
for 10 days, and the viral load increased to maximum until grafting for 21 days.
In the treatment B, ToCV
was detected after 14 days, and the virus load also increased to maximum with
the prolonging of time (shown in Fig. 4A). These results demonstrated that graft
inoculation of ToCV
was effective and the grafting inoculation with N. benthamiana as rootstock was more
beneficial to the infection of ToCV.
Effects
of different grafting methods on virus accumulation in tomato plants
We used two
different methods to graft healthy tomato plants onto pathogenetic N. benthamiana.
After grafting for 21 days, tomato plant leaves were collected for RT-PCR detection.
It was found that there was no significant difference in virus accumulation
between approach the grafting and cleft grafting methods (shown in Fig. 4B). However, the incidence of ToCV on tomato plants with different grafting methods
exhibited an obvious difference. The incidence of ToCV of the cleft grafting method
is as high as 79.08%, significantly higher than that of approach grafting
method (shown in Table 2). Therefore, the cleft grafting method was more favourable
for the graft-inoculation of ToCV with N. benthamiana as the rootstock.
Transmission
of ToCV
from grafting tomato by B. tabaci
The
newly-emerged adults of B. tabaci populations
were inoculated into grafting tomato to acquire ToCV in insect-proof cages for 48 h.
Following this, a single of B. tabaci was for RT-PCR detection. It was found that the ToCV fragment could be detected in
64.20% of B. tabaci
populations (shown in Fig. 5A). In
addition, veneniferous B. tabaci
populations were inoculated on healthy tomato plants for 48 h, and the target
fragment was detected in 85.98% of tomato plants with typical symptoms of ToCV (shown in
Fig. 5B).
Discussion
The ToCV was
initially detected in tomatoes and caused a huge loss in tomato production (Wisler et al. 1998a). According to the current
literature, ToCV
has been detected in tomato, pepper, eggplant, potato, lettuce, pumpkin, and
even some types of weeds (Lozano et al.
2004; Morris et al. 2006; Barbosa et al. 2011; Solórzano-Morales et al. 2011; Fortes and Navas-Castillo 2012; Orfanidou et al. 2014; Zhou et al. 2015; Şahin-Çevik et al. 2019), and still expanded its hosts (Fiallo-Olivé and Navas-Castillo
2019). It would be detrimental, if ToCV continues to increase its number of hosts without
effective control. Moreover, ToCV always infects plants together with multiple plant
viruses, for example, Tomato yellow leaf
curl virus (TYLCV), Tomato infectious
chlorosis virus (TICV) in agricultural production
(Zhao et al. 2014b; Dai et al. 2016; Ding et al. 2019). The co-infection of different viruses may be
beneficial for breaking through host resistance mechanisms and leading to
occurrence and epidemic of new diseases (Renteria-Canett
et al. 2011) which aroused great attention from researchers. Now, researchers typically use B. tabaci to feed on infected plant
in the laboratory to maintain ToCV for research purposes. As a vector of a variety of
plant viruses, it is almost impossible to ensure that there is only one type of
the viruses carried in B. tabaci
(Andret-Link and Fuchs 2005; Hohn
2007). Moreover,
inoculation using insect vector is always limited by sex, feeding conditions,
inoculation technique, etc., and that
is difficult to perform (Lapidot 2007; Polston and Capobianco 2013; Çevik et al. 2019).
Orílio et al. (2014) successfully constructed the infectious cDNA clone of ToCV, but the infectious clone could not effectively infect
the natural host tomato, but could infect the non-natural host, N. benthamiana. The same situation
occurred in
research involving Lettuce chlorosis virus (LCY) and Lettuce infectious yellows virus (LIYV), which also belonged to the
genus Crinivirus
(Wang et al. 2009; Chen et al. 2012). In our study, we used the infectious clone
of ToCV
provided by Zhao to infect tomato and N.
benthamiana.
The results showed both RNA1and RNA2 could be detected
in the tomato and N. benthamiana
plants, however, the detection rate of natural host tomato was very low and
lacked any symptom of ToCV.
Meanwhile, the newly-emerged healthy B. tabaci populations feeding on the tomato plants
infected by the infectious clone of ToCV failed to acquire the virus. It suggested that the
infectious clone might not successfully infect the natural host tomato. Whether
a plant virus can infect effectively a host depends on the result of
confrontation between virus increment and host defense (Cleene
and Ley 1976; Wroblewski et al. 2005; Cañizares et al. 2008). The reason for the failure to infect the
natural host may be defense responses of the tomato plants caused by
combinations of the A. rhizogenes strains C58C1 and ToCV, resulting in a low
efficiency of transformation. We also found that all the B. tabaci feeding on the ToCV-free N. benthamiana plants died out
within 6 h, while that feeding on the ToCV-infected N. benthamiana
plants died out within 12 h. It might be because that the virus had inhibited
the jasmonate (JA) -signalling
pathway of N. benthamiana plants, thereby
reduced the synthesis of terpenes, and improved the
suitability of B. tabaci
for N. benthamiana (Zhang et al.
2012; Luan et al. 2013; Fang et al. 2013).
Previous
studies have demonstrated that after infection by ToCV, the virions
can transmit in both directions through the phloem of a plant (Wisler et al.
1998a; Dovas and Katis
2002). Lee et al. (2017) grafted ToCV-infected
simple leaves into the phloem of tomato seedlings, with 87.8% of the plants
being infected with virus. Similarly, transplanting a section of ToCV-infected
tomato stem containing phloem tissue into the phloem of healthy tomato plants
also caused systemic infection in tomato plants (Çevik
et al. 2019). In general, virus
transmission by grafting is performed by grafting infected plants onto healthy
plants (Picó et al. 1996). In this study, by comparing the virus
accumulation between tomato rootstock and tobacco rootstock, it was found that
tobacco rootstock was more favorable to the virus accumulation in the tomato
plants. We grafted healthy tomato onto ToCV-infected N. benthamiana by
the approach grafting and cleft grafting methods. Both grafting methods
obtained the ToCV-infected
tomato plants, which had showed typical symptoms of ToCV. This indicated that viral
progeny of the infection clone had owned the ability to increase in tomato
plants after replicating in N. benthamiana.
Additionally, the ToCV
virion could be also transmitted effectively by B. tabaci
inoculated on graft-inoculated tomato plants. The graft inoculation method is
simple, efficient and easy to perform. Moreover, the method is not limited by
season and temperature. In particular, cleft grafting is more suitable when N. benthamiana is the rootstock for
grafting tomato plants, so it can be used as an effective method to obtain a
single infection of ToCV.
The graft inoculation of ToCV
will quicken the studies concerning the selection and breeding of germplasm resources, the mechanism of virus-host
interaction, etc., which have great
significance for further researches.
Conclusion
The graft inoculation of ToCV on tobacco
rootstock was established a stable and effective acquisition technology of ToCV from the
root. The method
could help to
quicken the studies concerning the selection and breeding of germplasm resources, the mechanism of virus-host
interaction, etc.
Acknowledgements
We thank Dr. N. Desneux
for comments on the design of the study and International
Science Editing (http://www.internationalscienceediting.com) for editing this
manuscript. The work has been supported
by the following grants: Shandong Key R&D Program (Public Welfare) (2019GSF109118),
Shandong Agricultural Major Applied Technology Innovation Project
(SD2019ZZ004), Weifang Science and Technology Planed
Project (2019GX074), Scientific
Research Project of Facility Horticulture Laboratory of Universities in
Shandong (2018YY002).
References
Albuquerque LC, F Villanueva, RO Resende, J Navas-Castillo, JC Barbosa, AK Inoue-Nagata (2013). Molecular
characterization reveals Brazilian Tomato
chlorosis virus to be closely related to a Greek
isolate. Trop Plant Pathol 38:332‒336
Andret-Link P, M Fuchs (2005). Transmission
specificity of plant viruses by vectors. J Plant Pathol
87:153‒165
Barbosa
JC, H Costa,
R Gioria, J Rezende
(2011). Occurrence of Tomato chlorosis virus in tomato crops in five Brazilian
states. Trop Plant Pathol 36:256‒258
Cañizares MC, J Navas-Castillo, E Moriones (2008). Multiple
suppressors of RNA silencing encoded by both genomic RNAs of the crinivirus, Tomato chlorosis virus. Virology 379:168‒174
Çevik B, H Kıvrak,
M Sahin-Cevik (2019). Development
of a graft inoculation method and a real-time RT-PCR assay for monitoring Tomato chlorosis
virus infection in tomato. J Virol Meth
265:1‒8
Chen
AYS, A Pavitrin, JCK Ng (2012). Agroinoculation
of the cloned infectious cDNAs of Lettuce chlorosis virus results in
systemic plant infection and production of whitefly transmissible virions. Vir Res 169:310‒315
Chu
D, XS Hu, CS Gao,
HY Zhao,
RL Nichols, XC Li (2012).
Use of mtCOI PCR-RFLP for
identifying subclades of Bemisia tabaci Mediterranean group. J
Econ Entomol 105:242‒251
Cleene MD, JD Ley (1976). The host range of crown gall. Bot Rev
42:389‒466
Dai
HJ, YG Liu, XP Zhu, YJ Liu, J Zhao
(2016). Tomato chlorosis
virus (ToCV)
transmitted by Bemisia tabaci
biotype Q of Shouguang in Shandong Province. J Plant
Prot 43:162‒167
Ding
TB, J Li,
EH Chen, JZ Niu,
D Chu
(2019). Transcriptome profiling of the Whitefly Bemisia tabaci MED in response to single infection of Tomato yellow leaf curl virus, Tomato chlorosis
virus and their co-infection. Front Physiol
10; Article 302
Dovas CI, NI Katis
(2002). Multiplex
detection of Criniviruses associated with epidemics
of a
yellowing disease of tomato in Greece. Plant Dis 86:1345‒1349
Fang
Y, X Jiao,
W Xie, S Wang,
Q Wu, X Shi, G Chen, Q Su, X Yang, H Pan, Y Zhang (2013). Tomato yellow leaf curl virus alters the host preferences of its
vector Bemisia tabaci. Sci Rep 3;
Article 2876
Fiallo-Olivé E, J Navas-Castillo
(2019).
Tomato chlorosis
virus, an emergent plant virus still expanding its
geographical and host ranges. Mol Plant Pathol 20:1307‒1320
Fortes
IM, J Navas-Castillo (2012). Potato, an
experimental and natural host of the Crinivirus Tomato chlorosis
virus. Eur J Plant Pathol 134:81‒86
Gao LL, GZ Sun, Y Wang, W Gao, CX Zhang, AS Zhang, XP Zhu (2015). Molecular
detection and identification of Tomato chlorosis virus in Tianjin. Acta
Bor-Sin 30:211‒215
Hohn T (2007). Plant
virus transmission from the insect point of view. Proc Natl Acad Sci 104:17905‒17906
Hu
JA, XJ Wan,
ZJ Li,
W Huang,
WG Li,
FQ Ying
(2015). Molecular identification on Tomato chlorosis virus in Henan Province.
Chin Veg 12:25‒28
Karate
AV (2000). Genetic
diversity and evolution of Closteroviruses.
Annu Rev Phytopathol 38:293‒324
Kataya ARA, E Stavridou, K Farhan, IC Livieratos (2008). Nucleotide sequence analysis and detection of a
Greek isolate of Tomato chlorosis virus. Plant Pathol 57:819‒824
Lapidot M (2007). Tomato Yellow Leaf Curl Virus disease.
In: Screening for TYLCV-resistance Plants
using Whitefly-mediated Inoculation, pp: 329‒342. Czosnek
H (ed). Springer, Dordrecht, Netherlands
Lee
H, MK Kim, HS Choi, JH Kang, HJ Ju, JK Seo (2017). Efficient
transmission and propagation of Tomato Chlorosis Virus by simple single-leaflet grafting.
Plant Pathol J 33:345‒349
Liu
HY, GC Wisler, JE Duffs (2000). Particle
lengths of whitefly-transmitted criniviruses. Plant
Dis 84:803‒805
Livieratos IC, E Eliasco, G Muller, RCL Olsthoorn, LF Salazar, CWA Pleij, RHA
Coutts
(2004). Analysis of the RNA of Potato
yellow vein virus: evidence for a tripartite genome and conserved
3-terminal structures among members of the genus Crinivirus.
J Gen Virol
85:2065‒2075
Lozano
G, E Moriones,
J Navas-Castillo
(2004).
First report of sweet pepper (Capsicum annuum) as a natural host plant
for Tomato chlorosis
virus. Plant Dis 88:224
Luan
JB, DM Yao,
T Zhang,
LL Walling, M Yang,
Y J Wang, SS Liu
(2013).
Suppression of terpenoid synthesis in plants by a
virus promotes its mutualism with vectors. Ecol Lett 16:390‒398
Martelli GP, AA Agranovsky, M Bar-Joseph, D Boscia, T Candresse, RHA Coutts, VV Dolja, BW Falk, D Gonsalves, W Jelkmann, AV Karasev, A Minafra, S Namba, HJ Vetten, GC Wisler, N Yoshikawa (2002). The family Closteroviridae revised. Arch Virol
147:2039‒2044
Morris
J, E Steel,
P Smith,
N Boonham,
N Spence,
L Barker
(2006).
Host range studies for Tomato chlorosis virus, and Cucumber vein yellowing virus transmitted by Bemisia. Eur
J Plant Pathol
114:265‒273
Navas-Castillo J, E Fiallo-Olive,
S Sanchez-Campos
(2011).
Emerging virus diseases transmitted by whiteflies. Annu
Rev Phytopathol 49:219‒248
Orfanidou CG, C Dimitriou,
LC Papayiannis, VI Maliogka, NI Katis
(2014). Epidemiology and genetic diversity of Criniviruses
associated with Tomato yellows disease
in Greece. Vir Res 186:120‒129
Orílio AF, IM Fortes,
J Navas-Castillo (2014). Infectious cDNA clones of the crinivirus Tomato chlorosis
virus are competent for systemic plant infection and whitefly-transmission.
Virology 464–465:365‒374
Picó B, MJ Díez,
F Nuez (1996). Viral diseases
causing the greatest economic losses to the tomato crop. II. The tomato yellow leaf curl virus – A review.
Sci Hortic 67:151‒196
Polston JE, H Capobianco (2013). Transmitting
plant viruses using whiteflies. J Visual Exp
81:1–10
Renteria-Canett I, B Xoconostle-Cázares,
R Ruiz-Medrano, RF Rivera-Bustamante (2011). Geminivirus
mixed infection on pepper plants: synergistic interaction between PHYVV and PepGMV. Virol J 8:1–14
Şahin-Çevik M, ED Sivri, B Çevik (2019). Identification and expression
analysis of genes induced in response to Tomato
chlorosis virus infection in tomato. Plant Pathol J 35:257‒273
Shi
X, X Tang,
X Zhang,
D Zhang, F Li,
F Yan, Y
Zhang, X Zhou, Y Liu
(2018). Transmission efficiency, preference and behavior of Bemisia tabaci MEAM1
and MED under the influence of Tomato chlorosis virus. Front Plant Sci 8; Article 2271
Solórzano-Morales
A, N Barboza, E Hernández, F MoraUmaña,
P Ramirez, RW Hammond
(2011).
Newly discovered natural hosts of Tomato chlorosis virus in Costa Rica.
Plant Dis.,
95:497
Tang
YF, ZF He,
XM She, GB Lan (2017). Molecular
identification of Tomato chlorosis virus infecting tomato in Guangdong Province.
Plant Prot 43:133‒137
Tsai
WS, SL Shih,
SK Green, P Hanson, HY Liu (2004). First report of the occurrence of Tomato chlorosis
virus and Tomato infectious chlorosis virus in Taiwan. Plant Dis
88:
311
Tzanetakis IE, RR Martin, W Wintermantel (2013). Epidemiology
of criniviruses, an emerging problem in world
agriculture. Front Microbiol 4; 119
Wang
CL, J Feng, XH Sun, SL Wang, J Zhao, JL Liu, XP Zhu (2017). Molecular identification of Tomato
chlorosis virus from four provinces or autonomous
region in northern China. Plant Prot
43:141‒145
Wang
J, M Turina, LR Stewart, JA Lindbo,
BW Falk (2009). Agroinoculation of the Crinivirus, Lettuce infectious yellows virus,
for systemic plant infection. Virology 392:131‒136
Wei KK, J Li, TB Ding, D Chu (2018). Research progress on
distribution, identification method of Tomato
chlorosis virus (ToCV) and whitefly transmission
characteristics. Chin Veg 1:19‒24
Wintermantel
WM, GC Wisler
(2006). Vector specificity, host range, and genetic diversity
of Tomato chlorosis
virus. Plant Dis 90:814‒819
Wintermantel
WM, GC Wisler,
AG Anchietal, HY Liu, AV Karate, IE Tzanetakis (2005). The complete nucleotide sequence and
genome organization of Tomato chlorosis virus. Arch Virol
150:2287‒2298
Wisler
GC, JE Duffs,
HY Liu,
RH Li (1998a). Ecology and epidemiology of
whitefly-transmitted closteroviruses. Plant
Dis 82:270‒280
Wisler
GC, RH Li,
HY Liu,
DS Lowry,
JE Duffs
(1998b). Tomato chlorosis
virus: a new whitefly-transmitted, phloem limited, bipartite closterovirus of tomato. Phytopathology 88:402‒409
Wroblewski
T, A Tomczak,
R Michelmore (2005). Optimization of Agrobacterium-mediated transient assays
of gene expression in lettuce, tomato and Arabidopsis.
Plant Biotechnol J 3:259‒273
Zhang T, JB Luan, JF Qi, CJ Huang, M Li, XP Zhou, SS Liu (2012). Begomovirus-whitefly
mutualism is achieved through repression of plant defences
by a virus pathogenicity factor. Mol Ecol 21:1294‒1304
Zhao LM, G Li, Y Gao, JY Liu, GZ Sun, XP Zhu (2014a.) Molecular detection and
complete genome sequences of Tomato chlorosis virus isolates from infectious outbreaks in
China. Phytopathology 162:627‒634
Zhao LM, G Li, YG Liu, JJ Guo, JP Wei, XP Zhu (2014b). Molecular identification on mixed
infections of Tomato chlorosis
virus and Tomato yellow leafcurlvirus. Chin Veg 12:15‒20
Zhao R, N Wang, S Liu, K Ling, Z Fan, T Zhou (2016).
P22 of Tomato chlorosis
virus, an RNA silencing suppressor, is naturally expressed in the infected
plant. Acta Virol
60:423‒425
Zhao RN, R Wang, N Wang, ZF Fan, T Zhou, YC Shi, M Chai (2013).
First report of Tomato chlorosis virus in China. Plant Dis 97:1123
Zheng
HX, JX Xia,
XM Zhou,
YJ Zhang
(2016). Be on alert of rapid diffusion of Tomato
chlorosis virus transmitted by whitefly in China.
Chin Veg 4:22‒26
Zhou Y, JY Yan, GH Qiao, M Liu, W Zhang, XH Li
(2015). First
report of Tomato chlorosis
virus infecting eggplant (Solanum melongena) in China. Plant Dis 99:1657